Uses of Class
org.snpeff.interval.Gene
Packages that use Gene
Package
Description
-
Uses of Gene in org.snpeff.geneSets
Methods in org.snpeff.geneSets with parameters of type Gene -
Uses of Gene in org.snpeff.interval
Methods in org.snpeff.interval that return GeneModifier and TypeMethodDescriptionGene.circularClone()
In a circular genome, a gene can have negative coordinates or crosses over chromosome end.Gene.cloneShallow()
Obtain a gene intervalTranscript.getGene()
Genes.getGeneByName
(String geneName) Obtain a gene by GeneName WARNING: The first match is returned.Methods in org.snpeff.interval that return types with arguments of type GeneModifier and TypeMethodDescriptionGenome.getGenesSorted()
Create a sorted list of genes (sorted by gene Id)Genome.getGenesSortedPos()
Create a sorted list of genes (sorted by genomic position)Genes.iterator()
Genes.sorted()
Genes.values()
Methods in org.snpeff.interval with parameters of type GeneModifier and TypeMethodDescriptionvoid
Add a gene interval to this collectionstatic Intergenic
Intergenic.createIntergenic
(Gene geneLeft, Gene geneRight) Creates an intergenic marker based on the "space" between two genesConstructors in org.snpeff.interval with parameters of type GeneModifierConstructorDescriptionTranscript
(Gene gene, int start, int end, boolean strandMinus, String id) -
Uses of Gene in org.snpeff.snpEffect
Methods in org.snpeff.snpEffect that return GeneModifier and TypeMethodDescriptionObtain a gene by geneIdVariantEffect.getGene()
VariantEffectFusion.getGene()
VariantEffectStructural.getGene()
VariantEffectFusion.getGeneLeft()
VariantEffectFusion.getGeneRight()
SnpEffectPredictor.queryClosestGene
(Marker inputInterval) Find closest gene to this markerMethods in org.snpeff.snpEffect that return types with arguments of type GeneMethods in org.snpeff.snpEffect with parameters of type Gene -
Uses of Gene in org.snpeff.snpEffect.factory
Methods in org.snpeff.snpEffect.factory that return GeneModifier and TypeMethodDescriptionprotected Gene
protected Gene
Create and add a gene based on GffMarkerprotected Gene
protected Gene
protected Gene
SnpEffPredictorFactoryGff.findOrCreateGene
(GffMarker gffMarker) Find or create a gene based on GffMarkerMethods in org.snpeff.snpEffect.factory with parameters of type Gene -
Uses of Gene in org.snpeff.snpEffect.testCases.integration
Fields in org.snpeff.snpEffect.testCases.integration declared as Gene -
Uses of Gene in org.snpeff.snpEffect.testCases.unity
Fields in org.snpeff.snpEffect.testCases.unity declared as GeneMethods in org.snpeff.snpEffect.testCases.unity with parameters of type GeneModifier and TypeMethodDescriptionprotected void
TestCasesStructuralInv.checkEffects
(Variant variant, EffectType[] expEffs, String[] expHgvsc, VariantEffect.EffectImpact expectedImpact, String[] expAnns, Gene[] genesToAdd) protected void
TestCasesBase.initSnpEffPredictor
(Gene[] genesToAdd) Create a predictor For the default parameters the first predictor created has only one transcript: 1:880-1001, strand: +, id:transcript_0, Protein Exons: 1:880-1001 'exon_0_0', rank: 1, frame: ., sequence: taaccccatatgattagtacggtagaggaaaagcacctaacccccattgagcaggatctctttcgtaatactctgtatcgatgaccgatttatttgattccccacatttatttcatcggga CDS : taaccccatatgattagtacggtagaggaaaagcacctaacccccattgagcaggatctctttcgtaatactctgtatcgatgaccgatttatttgattccccacatttatttcatcgggac Protein : *PHMISTVEEKHLTPIEQDLFRNTLYR*PIYLIPHIYFIG? -
Uses of Gene in org.snpeff.stats
Methods in org.snpeff.stats with parameters of type GeneModifier and TypeMethodDescriptiondouble
Expected number of sequences (average between plus and minus strand)int
Observed sequence (average between plus and minus strand)double
Observed over expected ratiovoid
GeneCountByTypeTable.sample
(Gene gene, Transcript tr, String type, VariantEffect variantEffect) Sample this <gene, marker, type, variant> tuple to update statistics -
Uses of Gene in org.snpeff.svg
Constructors in org.snpeff.svg with parameters of type Gene -
Uses of Gene in org.snpeff.vcf
Constructors in org.snpeff.vcf with parameters of type Gene