Bio.Restriction package
Submodules
- Bio.Restriction.PrintFormat module
PrintFormatPrintFormat.ConsoleWidthPrintFormat.NameWidthPrintFormat.MaxSizePrintFormat.CmoduloPrintFormat.PrefWidthPrintFormat.IndentPrintFormat.linesizePrintFormat.print_as()PrintFormat.format_output()PrintFormat.print_that()PrintFormat.make_format()PrintFormat.__annotations_cache__PrintFormat.__firstlineno__PrintFormat.__static_attributes__
- Bio.Restriction.Restriction_Dictionary module
Module contents
Restriction Digest Enzymes.
Examples
>>> from Bio.Seq import Seq
>>> from Bio.Restriction import *
>>> pBs_mcs = "GGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCGAATTCCTG"
>>> pBs_mcs += "CAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTC"
>>> seq = Seq(pBs_mcs) # Multiple-cloning site of pBluescript SK(-)
>>> a = Analysis(AllEnzymes, seq)
>>> a.print_that() # no argument -> print all the results
AbaSI : 10, 12, 13, 16, 17, 18, 19, 20, 22, 23, 24, 25, 25, 26, 27...
BmeDI : 7, 8, 8, 9, 9, 13, 14, 15, 16, 17, 18, 19, 19, 21, 21...
YkrI : 10, 12, 13, 16, 16, 17, 19, 20, 21, 22, 23, 24, 25, 25, 26...
BmeDI : 1, 2, 7, 8, 8, 9, 9, 13, 14, 15, 16, 17, 18, 19...
AccII : 98.
AciI : 86, 90, 96, 98...
Enzymes which do not cut the sequence.
AspLEI BstHHI CfoI CviAII FaeI FaiI FatI GlaI
HhaI Hin1II Hin6I HinP1I HpyCH4IV HpySE526I Hsp92II HspAI
MaeII MseI NlaIII SaqAI TaiI Tru1I Tru9I...
>>> b = a.blunt() # Analysis with blunt enzymes
>>> a.print_that(b) # Print results for blunt cutters
AccII : 98.
AfaI : 4.
AluBI : 40, 106.
AluI : 40, 106.
Bsh1236I : 98.
BshFI : 10, 89.
BsnI : 10, 89.
BspANI : 10, 89...
Enzymes which do not cut the sequence.
FaiI GlaI CdiI MlyI SchI SspD5I AanI...